oligonucleotide controls and probes  (Corning Life Sciences)

Journal: PLoS Biology

Article Title: Long noncoding RNA PM maintains cerebellar synaptic integrity and Cbln1 activation via Pax6/Mll1-mediated H3K4me3

doi: 10.1371/journal.pbio.3001297

Figure Lengend Snippet: (A) Left: illustration of 12 Gm2694 isoforms indicated as different colors. The sh PM -1, sh PM -2, and sh PM -3 used in the study were indicated. Right: the relative expression levels of the 12 isoforms of Gm2694 in the indicated brain regions. Data are shown as means ± SEMs, n = 3. Gm2694-204 is designated as lncRNA-PM (PM). (B) The relative expression levels of Gm2694 (for 201 , 202 , 203 , 205 , 206 , 207 , 209 , and 210 ), Gm2694-201 , PM , Gm2694-205 , Gm2694-207 , and Cbln1 at the indicated cerebellar developmental time points were measured by RT-qPCR. Data are shown as means ± SEMs, n = 3. (C, D) The expression levels of the indicated Gm2694 isoforms (C) and Cbln1 (D) under the indicated treatments. (E) The expression levels of Cbln1 in control or PM shRNAs (sh PM -1/2/3)-treated Neuro2a cells, detected by RT-qPCR. Data are shown as means ± SEMs, n = 3. (F) Left: representative images of Cbln1 mRNA in the control or PM -overexpressed Neuro2a cells, detected by FISH. Right: quantification of the left. Data are shown as means ± SEMs, n = 3. (G) Left: representative immunofluorescence images of Cbln1 protein in the control (Vector) or PM- overexpressed (PM) Neuro2a cells. Right: quantification of the left. Data are shown as means ± SEMs, n = 3. (H) Subcellular distributions of PM , Gapdh , and Neat1 by fractionating assay in Neuro2a cells. Gapdh and Neat1 RNA served as positive controls for RNAs predominantly expressed in cytoplasm and nucleus, respectively. Data are shown as means ± SEMs, n = 3. (I) Representative FISH image of PM RNA (red) in Neuro2a cells. Nuclei were stained with DAPI (blue). (J) Top: schematic illustration of the Cbln1 / PM locus. Bottom left: luciferase assays indicate the activity changes of pGL3- Cbln1 (blue) and pGL3 -Gm2694 (red), compared with pGL3 vector control (black). Bottom right: Luciferase assays indicate the activity changes of pGL3- Cbln1 in the presence of control or PM -expressing plasmid. Data are shown as means ± SEMs, n = 3. Scale bar, 13 um. All RT-qPCR results were normalized to Gapdh . All the data of this figure can be found in the file. * P < 0.05, ** P < 0.01, and *** P < 0.001. Cbln1 , Cerebellin-1 ; Cereb, Cerebellum; FISH, fluorescence in situ hybridization; Hippo, hippocampus; Hypo, hypothalamus; lncRNA-PM , lncRNA-Promoting Methylation ; OB, olfactory bulb; RT-qPCR, reverse transcription-quantitative PCR.

Article Snippet: Antisense RNA oligonucleotides (probes) for lncRNA-PM and LacZ (negative control) were designed by Biosearch Technologies website ( https://www.biosearchtech.com/stellarisdesigner/ ) and synthesized with 3′-biotin-TEG modification (Sangon, China).

Techniques: Expressing, Quantitative RT-PCR, Immunofluorescence, Plasmid Preparation, Staining, Luciferase, Activity Assay, Fluorescence, In Situ Hybridization, Methylation, Real-time Polymerase Chain Reaction

Journal: PLoS Biology

Article Title: Long noncoding RNA PM maintains cerebellar synaptic integrity and Cbln1 activation via Pax6/Mll1-mediated H3K4me3

doi: 10.1371/journal.pbio.3001297

Figure Lengend Snippet: (A) Illustrated structure in the investigated cerebellar area. (B) The expression levels of PM (red) and Cbln1 (green) RNA in the cerebellar sections obtained from control (AAV NC) or lncRNA-PM ( PM , red) shRNA-injected mice (AAV sh PM -1 and AAV sh PM -2). Scale bar, 40 um. (C and D) Immunofluorescence images of Cbln1 protein (C) and H3K27ac (D) in the cerebellar sections obtained from AAV NC and AAV sh PM s mice. Scale bar, 40 um. (E) Quantification of the RNA levels of PM and Cbln1 obtained from B. Data are shown as means ± SEMs, n = 3. (F) Quantification of the protein levels of Cbln1 obtained from C. (G) Quantification of the GC numbers. (H) Evaluation of the control and sh PM s-injected mice on cylinder test. Cylinder test was designed to assess limb preference on mice. It showed that compared with the control mice, PM shRNA-injected mice exhibited asymmetric high frequency in forepaw usage. The paw usage was counted and analyzed by normal-impaired/all. Data are shown as means ± SEMs, n = 7 (per group). (I) Evaluation of the control and sh PM s-injected mice on rotarod test. Latency to fall provides the quantification of motor ability on the accelerating rotarod. It showed that compared with the control mice, sh PM s-injected mice exhibited significant reduced duration in latency to fall. Data are shown as means ± SEMs, n = 6 (per group). (J) Representative electron microscope images for the control and sh PM -injected mice. Red asterisk: intact synapse. Yellow triangle: free spine. Scale bar, 500 nm. (K) Quantification of the numbers of intact synapses obtained from J in the indicated treatments. (L) Quantification of the numbers of free spines obtained from (J) in the indicated treatments. All the data of this figure can be found in the file. * P < 0.05, ** P < 0.01, and *** P < 0.001. Cbln1 , Cerebellin-1 ; GCL, granule cell layer; lncRNA-PM , lncRNA-Promoting Methylation ; ML, molecular layer; PCL, Purkinje cell layer; WM, white matter.

Article Snippet: Antisense RNA oligonucleotides (probes) for lncRNA-PM and LacZ (negative control) were designed by Biosearch Technologies website ( https://www.biosearchtech.com/stellarisdesigner/ ) and synthesized with 3′-biotin-TEG modification (Sangon, China).

Techniques: Expressing, shRNA, Injection, Immunofluorescence, Microscopy, Methylation

Journal: PLoS Biology

Article Title: Long noncoding RNA PM maintains cerebellar synaptic integrity and Cbln1 activation via Pax6/Mll1-mediated H3K4me3

doi: 10.1371/journal.pbio.3001297

Figure Lengend Snippet: (A) UV-RIP assay showed PM :Pax6 and PM :Mll1 interactions in mouse cerebellum. Neat1 and lncRNA-lhx1os : negative controls. Data are shown as means ± SEMs, n = 3. (B) RT-qPCR detection following PM RNA pull-down using cerebellum tissue. PM: PM probes; LacZ: control probes. (C) Illustration of H3K4me3 signature on the upstream regulatory region of Cbln1 locus from +300 to −2,000 base pair based on ENCODE data in mouse cerebellum. The 14 pairs of amplicons are indicated. (D) ChIRP-qPCR showed occupancy of PM to the regions amplified by the indicated 14 amplicons and a control region that is 85 kb upstream of Cbln1 transcription start site (Far Region). Data are shown as means ± SEMs, n = 3. (E) Re-ChIP of Pax6 and Mll1. Top: illustrated flowchart of double ChIP experiment. Bottom left: recruitments of Pax6 or IgG to Cbln1 or the negative control region (Far Region) after first ChIP in mouse cerebellum. Bottom right: recruitments of Mll1 or IgG to Cbln1 or Far Region after second ChIP in mouse cerebellum. Data are shown as means ± SEMs, n = 3. (F) Model: LncRNA - PM mediates the transcriptional activation of Cbln1 through Pax6/Mll1-mediated H3K4me3 and maintains mouse motor coordination and motor learning. All the data of this figure can be found in the and Data files. * P < 0.05, ** P < 0.01, and *** P < 0.001. Cbln1 , Cerebellin-1 ; ChIP, chromatin immunoprecipitation; ChIRP, chromatin isolation by RNA purification; IgG, immunoglobulin G; lncRNA-PM , lncRNA-Promoting Methylation ; ns, no significance; qPCR, quantitative PCR; Re-ChIP, Re-chromatin immunoprecipitation; RT-qPCR, reverse transcription-quantitative PCR; UV-RIP, UV-RNA immunoprecipitation.

Article Snippet: Antisense RNA oligonucleotides (probes) for lncRNA-PM and LacZ (negative control) were designed by Biosearch Technologies website ( https://www.biosearchtech.com/stellarisdesigner/ ) and synthesized with 3′-biotin-TEG modification (Sangon, China).

Techniques: Quantitative RT-PCR, Amplification, Negative Control, Activation Assay, Chromatin Immunoprecipitation, Isolation, Purification, Methylation, Real-time Polymerase Chain Reaction, Immunoprecipitation

Journal: PLoS Biology

Article Title: Long noncoding RNA PM maintains cerebellar synaptic integrity and Cbln1 activation via Pax6/Mll1-mediated H3K4me3

doi: 10.1371/journal.pbio.3001297

Figure Lengend Snippet: (A) Left: heatmap of dysregulated genes (|Fold change|>1.5, FDR < 0.05) in PM knockdown and Pax6 overexpression RNA-seq. Right: GO biological processes of PM and Pax6 coregulated genes. Red: positively regulated genes shared by PM and Pax6 . Blue: negatively regulated genes shared by PM and Pax6 . (B) Modulations of lncRNA-PM and Pax6 impact neuronal associated genes. Expression changes for selected genes are shown as the log2 expression ratio. Red: positively regulated genes shared by PM and Pax6 . Blue: negatively regulated genes shared by PM and Pax6 . (C and D) qPCR detection of the indicated genes upon PM knockdown (C) and Pax6 overexpression (D). All the data of this figure can be found in the file. Data are shown as means ± SEMs, n = 3. * P < 0.05, ** P < 0.01, and *** P < 0.001. FDR, false discovery rate; GO, Gene Ontology; lncRNA-PM , lncRNA-Promoting Methylation ; ns, no significance; qPCR, quantitative PCR; RNA-seq, RNA sequencing.

Article Snippet: Antisense RNA oligonucleotides (probes) for lncRNA-PM and LacZ (negative control) were designed by Biosearch Technologies website ( https://www.biosearchtech.com/stellarisdesigner/ ) and synthesized with 3′-biotin-TEG modification (Sangon, China).

Techniques: Over Expression, RNA Sequencing Assay, Expressing, Methylation, Real-time Polymerase Chain Reaction

Journal: Journal for Immunotherapy of Cancer

Article Title: p50 suppresses cytotoxic T lymphocyte effector function to regulate tumor immune escape and response to immunotherapy

doi: 10.1136/jitc-2020-001365

Figure Lengend Snippet: p50 binds to a κB sequence element in the Gzmb promoter to repress Gzmb expression in T cells. (A) The structure of the mouse Gzmb promoter region showing the putative NF-κB-binding sequences (P1–8) and locations. (B) Nuclear extracts were prepared from EL4 T cells and analyzed by EMSA using putative Gzmb promoter DNA probes 7 and 8 as shown in (A). The NF-κB consensus sequence probe (control probe) was used as positive control. The black arrow indicates the NF-κB–DNA complex and the gray arrow indicates p50 mAb-induced supershift. Shown are p50 binding to probe 8. Probe 7 is shown here as a negative control. (C) The left panel shows the mouse Gzmb promoter structure. The putative NF-κB-binding sequence (P8) and the ChIP PCR primer sequence locations are shown. The numbers under the bar and above the P8 probe sequence indicate the nucleotide locations relative to Gzmb transcription start site. EL4 T cells were analyzed by ChIP using IgG and p50-specific antibody, respectively. The immunoprecipitated DNA were quantified by qPCR using primers that amplify the Gzmb promoter DNA as shown at the left panel.

Article Snippet: The positive control κB probe sequence is AGTTGAGGGGACTTTCCCAGGC (Santa Cruz cat no. sc-2505).

Techniques: Sequencing, Expressing, Binding Assay, Control, Positive Control, Negative Control, Immunoprecipitation

Journal: BMC molecular biology

Article Title: Early growth response protein 1 regulates promoter activity of α-plasma membrane calcium ATPase 2, a major calcium pump in the brain and auditory system.

doi: 10.1186/s12867-017-0092-1

Figure Lengend Snippet: Fig. 3 Transcription factors of interest and their binding sites in the αAtp2b2 [+101/−2133] promoter. Transcription factors were selected based on a multi-faceted in silico search. a Predicted transcription factor binding sites were found using software (TFBIND and MatInspector) or manually identified using published consensus sequences [17]. Hair cell expression was determined utilizing SHIELD data [27, 39]. SHIELD RNA-Seq data was collected from FACS sorted GFP expressing hair cells, transcripts with reads above zero were considered expressed and denoted in the table with a (+). b Transcription factor expression in OC-1 cells was determined utilizing qPCR and cross-referenced with published microarray data. EGR1, GATA3 and USF1 are expressed [25–27, 40]. Data is the average of three technical replicates for three biological replicates, variation is shown as standard error of the mean. c Predicted binding sites for ATOH1, EGR1, GATA3, POU4F3 and USF1 are shown. Note the clustering of predicted bind- ing sites for transcription factors in the CpG island

Article Snippet: The Santa Cruz EGR1 control probe was purchased from Santa Cruz Biotechnology (SC-2529).

Techniques: Binding Assay, In Silico, Software, Expressing, RNA Sequencing, Microarray

Journal: BMC molecular biology

Article Title: Early growth response protein 1 regulates promoter activity of α-plasma membrane calcium ATPase 2, a major calcium pump in the brain and auditory system.

doi: 10.1186/s12867-017-0092-1

Figure Lengend Snippet: Fig. 4 Co-expression of transcription factors with promoter constructs. a Luciferase activity of the αAtp2b2 promoter construct [+572/−2133] when co-expressed with transcription factor constructs or empty vector. Luciferase activity of the [+572/−2133] αAtp2b2 promoter construct co- expressed with transcription factor constructs was normalized to the luciferase activity of the [+572/−2133] promoter co-transfected with empty vector. Values were compared to a theoretical value of 1 utilizing a one-sample t test (*P ≤ 0.05, **P ≤ 0.01). b To narrow down the site of EGR1 acti- vation in the αAtp2b2 promoter, three promoter truncations were assayed. The promoter truncation constructs were co-transfected with EGR1 or empty vector. Luciferase activity of promoter constructs co-transfected with EGR1 were normalized to luciferase activity of the promoter construct co-expressed with empty vector. Normalized values were compared to a theoretical value of 1 using a one sample t test (*P ≤ 0.05 and **P ≤ 0.01). Activation occurs over baseline promoter activity in all three constructs suggesting that the EGR1 binding site is contained in the region of the CpG island. Data for the αAtp2b2 promoter luciferase construct [+572/−2133] is the same in both a and b. Data shown is the average of three biological replicates for at least three experiments, variation is shown as standard error of the mean, dashed line represents the theoretical value of 1

Article Snippet: The Santa Cruz EGR1 control probe was purchased from Santa Cruz Biotechnology (SC-2529).

Techniques: Expressing, Construct, Luciferase, Activity Assay, Plasmid Preparation, Transfection, Activation Assay, Binding Assay

Journal: BMC molecular biology

Article Title: Early growth response protein 1 regulates promoter activity of α-plasma membrane calcium ATPase 2, a major calcium pump in the brain and auditory system.

doi: 10.1186/s12867-017-0092-1

Figure Lengend Snippet: Fig. 5 Effect of overexpression of Atoh1 and Egr1 on endogenous levels of Atp2b2 and Atp2b4. a, b EGR1 increases expression of Atp2b2 in both OC-1 and N2A cell lines. ATOH1 moderately inhibits expression of Atp2b2 in OC-1 (ns) and has no effect in N2A cells. c, d Atp2b4 transcript expres- sion is unaffected by overexpression of EGR1 in both OC-1 and N2A cells. ATOH1 increases expression of Atp2b4 transcript in OC-1 cells but not in N2A cells. Comparisons to empty vector (PIE) were made using a Student’s t test (*P ≤ 0.05, **P ≤ 0.01). Data shown is the average of three techni- cal replicates for three biological replicates in each cell line, variation is shown as standard error of the mean

Article Snippet: The Santa Cruz EGR1 control probe was purchased from Santa Cruz Biotechnology (SC-2529).

Techniques: Over Expression, Expressing, Plasmid Preparation